Alapértelmezett nézet
Kapcsolat Bejelentkezés
Az egyetem Munkatársak Maróti-Agóts Ákos

Maróti-Agóts Ákos

Név

Dr. Maróti-Agóts Ákos

Végzettség
állatorvos doktor, PhD, habil
Szervezeti egység
Állattenyésztési és Genetikai Tanszék
Beosztás: tanszékvezető helyettes
Telefon
(1) 478 4251
Mellék
(1) 478 4100 / 8601
Helyszín
J épület III. emelet 305.
h

Bemutatkozás  

Végzettség: állatorvos doktor (2003)
Tudományos fokozat: PhD (2011) PhD/CSc kiadó intézmény: SzIE-ÁOTK
PhD/CSc oklevél anyakönyvi száma: 42/2011
a PhD/CSc értekezés címe: A magyar szürke szarvasmarhafajta fenotípusos és genotípusos vizsgálata

Habilitáció: 2016 ÁTE

Szakterület: Videokép Analizálásos Testméretfelvétel (VATEM), filogenetikai kutatások mitokondriális örökítőanyag felhasználásával szarvasmarha fajban, házi- és társállatok örökletes betegségeinek molekuláris diagnosztikája, kutya mozgásanalízis -mozgásszervi megbetegedések diagnosztikai lehetőségének vizsgálata, a podóliai fajtakör küllemi vizsgálata VATEM módszerrel

Gyakorlat: örökletes betegségek molekuláris diagnózisa, küllemi bírálat, fajtatan

Nyelvismeretek
Angol közép fokon ír és beszél (C)
Német közép fokon ír és beszél (C)

Szűkebb szakterület állattenyésztési genetika, génmegőrzés, 3D képalkotás, genetikai betegségek molekuláris diagnózisa, bioinformatika

Főbb kutatási területek:

  • Fenotipizálás korszerű eszközei
  • Őshonos fajták filogenetikai kutatásai
  • Magyar kutyafajták beltenyésztéses leromlásának megakadályozása (FEDO.HU)

Előrehaladás

Munkahelyek Intézmény beosztás
2009- SZIE-ÁOTK tudományos munkatárs – kutató
2006 – SZIE-ÁOTK intézeti állatorvos – kutató
2003 – SZIE-ÁOTK doktorandusz

 

 Eddigi szakdolgozat/TDK hallgatók száma

13

PhD-hallgatók
 1

 

Publikációs lista (Top10)

2021 Gaspardy A, Berger B, Zabavnik-Piano J, Kovacs E, Annus K, Zenke P, Safar L, Maroti-Agots A: Comparison of mtDNA control region among descendant breeds of the extinct Zaupel sheep revealed haplogroup C and D in Central Europe, VETERINARY MEDICINE AND SCIENCE 
2021 Maróti-Agóts Ákos, Csurgay Kristóf: “Egy borjúfark sem hibázott…”, , 2021 *
2020 Kovács Endre, Maróti-Agóts Ákos, Harmat Levente, Annus Kata, Zenke Petra, Tempfli Károly, Sáfár László, Gáspárdy András: A cikta juh jellemzése a mitokondriális DNS kontrollrégiója alapján, MAGYAR ÁLLATORVOSOK LAPJA 142: (7) pp. 421-428., 2020
Veterinary (miscellaneous) 183/200 (Q4)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *
2020 Zsolnai A., Maróti-Agóts Á., Kovács A., Bâlteanu A. V., Kaltenecker E., Anton I.: Genetic position of Hungarian Grey among European cattle and identification of breed-specific markers, ANIMAL: THE INTERNATIONAL JOURNAL OF ANIMAL BIOSCIENCES 14: (9) pp. 1786-1792., 2020; doi:10.1017/S1751731120000634
Animal Science and Zoology 47/419 (Q1)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *
2019 Kovács Endre, Tempfli Károly, Shannon A., Zenke P., Maróti-Agóts Ákos, Sáfár L., Á. Bali Papp Ágnes, Gáspárdy András: STR diversity of a historical sheep breed bottlenecked, the Cikta, JOURNAL OF ANIMAL AND PLANT SCIENCES 29: (1) pp. 41-47., 2019
Animal Science and Zoology 257/401 (Q3)
(Scopus rangsor: folyóirat pozíciója/lista hossza)
2019 Maróti-Agóts Ákos, Novák Tamás: “Lélek és betű”, , 2019 *
2018 A Beck, I Bodó, L Jávorka, A Gáspárdy, M Szemenyei, Á Maróti-Agóts: Phenotyping of Hungarian Grey bulls with the optometric VATEM method and launch of the PHENBANK, In: EAAP, Scientific Committee (szerk.) Book of Abstracts of the 69th Annual Meeting of the European Federation of Animal Science, Wageningen Academic Publishers (2018) p. 288., 2018 *
2018 Gáspárdy András, Holly Viktoria, Zenke Petra, Maróti-Agóts Ákos, Sáfár László, Bali Papp Ágnes, Kovács Endre: The response of prion genic variation to selection for scrapie resistance in Hungarian indigenous sheep breeds, ACTA VETERINARIA HUNGARICA 66: (4) pp. 562-572., 2018; doi:10.1556/004.2018.050
Veterinary (miscellaneous) 53/181 (Q2)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *
2017 Á Maróti-Agóts, D Fürlinger, I Bodó, L Baracskay, E Kaltenecker, A Gáspárdy: Changing of the wither height in Hungarian Grey cattle breed in the last 15 years, In: EAAP, scientific committee (szerk.) Book of Abstracts of the 68th Annual Meeting of the European Federation of Animal Science, Wageningen Academic Publishers (2017) p. 486., 2017 *
2017 Maróti-Agóts Ákos, Bodó Imre, Zenke Petra, Jávorka Levente, Kaltenecker Endre, Baracskay Lajos, Beck Attila, Fürlinger Dóra, Szemenyei Márton, Ratkóczi Omár, Gáspárdy András: VATEM2 – Optometriai állatmérő rendszer, MAGYAR ÁLLATORVOSOK LAPJA 139: (8) pp. 501-508., 2017
Veterinary (miscellaneous) 146/174 (Q4)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *
2017 Seregi B, Kapitány B, Maróti-Agóts Á, Rihmer Z, Gonda X, Döme P: Weak associations between the daily number of suicide cases and amount of daily sunlight, PROGRESS IN NEURO-PSYCHOPHARMACOLOGY & BIOLOGICAL PSYCHIATRY 73: pp. 41-48., 2017; doi:10.1016/j.pnpbp.2016.10.003
Pharmacology 35/325 (Q1)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *
2011 Maróti-Agóts Á, Bodó I, Jávorka L, Gyurmán A, Solymosi N, Zenke P, Skogseth M, Zöldág L: Possible genetic sign of heat stress adaptation in Hungarian Grey Bos taurus breed, ACTA BIOLOGICA HUNGARICA (1983-2018) 62: (1) pp. 65-72., 2011; doi:10.1556/ABiol.61.2011.1.6
Biochemistry, Genetics and Molecular Biology (miscellaneous) 122/230 (Q3)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *
2010 Pariset L, Mariotti M, Nardone A, Soysal MI, Ozkan E, Williams JL, Dunner S, Leveziel H, Maroti-Agots A, Bodo I, Valentini A: Relationships between Podolic cattle breeds assessed by single nucleotide polymorphisms (SNPs) genotyping., JOURNAL OF ANIMAL BREEDING AND GENETICS-ZEITSCHRIFT FÜR TIERZUCHTUNG UND ZUCHTUNGSBIOLOGIE 127: (6) pp. 481-488., 2010; doi:10.1111/j.1439-0388.2010.00868.x
Animal Science and Zoology 51/363 (Q1)
(Scopus rangsor: folyóirat pozíciója/lista hossza) *

 

 

BioinfDEU

LWFS seq
GTTCGTGCTGGGCATCATCGGAAACTCCACACT